FRB-GFP-Gab2(Y604F/Y634F)
(Plasmid #188659)

• Purpose: FRB coupled to GFP tagged Gab2 with Shp2 binding sites mutated to Phe
• Depositing Lab: Andrei Karginov
• Publication: Fauser et al J Cell Biol. 2022 Aug 1;221(8). pii: 213352. doi: 10.1083/jcb.202111066. Epub 2022 Jul 13.

Backbone

• Vector backbone: pEGFP-C1
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 6995
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GRB associated binding protein 2
• Alt name: Gab2
• Species: M. musculus (mouse)
• Insert Size (bp): 2000
• Mutation: Y604F and Y634F
• Entrez Gene: Gab2 (a.k.a. D130058I17Rik, p97)
• Promoter: CMV
• Tags / Fusion Proteins:
  • GFP (N terminal on backbone)
  • FRB (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry