Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

RapR-Shp2-mVenus-flag
(Plasmid #188655)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 188655 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5788
  • Total vector size (bp) 8597
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Shp2
  • Alt name
    PTPN11
  • Mutation
    iFKBP insertion at V406 with deletion of residues 405-407
  • Promoter CMV
  • Tags / Fusion Proteins
    • mVenus (C terminal on insert)
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RapR-Shp2-mVenus-flag was a gift from Andrei Karginov (Addgene plasmid # 188655 ; http://n2t.net/addgene:188655 ; RRID:Addgene_188655)
  • For your References section:

    Dissecting protein tyrosine phosphatase signaling by engineered chemogenetic control of its activity. Fauser J, Huyot V, Matsche J, Szynal BN, Alexeev Y, Kota P, Karginov AV. J Cell Biol. 2022 Aug 1;221(8). pii: 213352. doi: 10.1083/jcb.202111066. Epub 2022 Jul 13. 10.1083/jcb.202111066 PubMed 35829702