pUC19 EGFRup-CD3ε-mNeonGreen-EGFRdown
(Plasmid
#188634)
-
PurposeHDR template for CD3ε-mNeonGreen knock-in at C-terminus of human EGFR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188634 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 4861
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFR
-
Alt nameERBB
-
SpeciesH. sapiens (human), Synthetic
-
Entrez GeneEGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, NNCIS, PIG61, mENA)
-
Tag
/ Fusion Protein
- CD3ε-mNeonGreen (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agctggcacgacaggtttcccgactggaaagc
- 3′ sequencing primer tcgcgcgtttcggtgatgacgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.08.13.503850 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19 EGFRup-CD3ε-mNeonGreen-EGFRdown was a gift from Jared Toettcher (Addgene plasmid # 188634 ; http://n2t.net/addgene:188634 ; RRID:Addgene_188634) -
For your References section:
pYtags enable spatiotemporal measurements of receptor tyrosine kinase signaling in living cells. Farahani PE, Yang X, Mesev EV, Fomby KA, Brumbaugh-Reed EH, Bashor CJ, Nelson CM, Toettcher JE. eLife. 2023 May 22;12:e82863. doi: 10.7554/eLife.82863. 10.7554/eLife.82863 PubMed 37212240