pX330 EGFR-sgRNA
(Plasmid #188633)

• Purpose: A human codon-optimized SpCas9 and chimeric guide RNA targeting C-terminus of human EGFR
• Depositing Lab: Jared Toettcher
• Publication: Farahani et al eLife. 2023 May 22;12:e82863. doi: 10.7554/eLife.82863.

Backbone

• Vector backbone: pUC ori vector
• Total vector size (bp): 8487
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: humanized S. pyogenes Cas9
• Alt name: SpCas9
• Alt name: hSpCas9
• Insert Size (bp): 4272
• Promoter: CBh
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: agggatggttggttggtggg
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT

Resource Information

• Supplemental Documents:
  • pX330 EGFR-sgRNA.gb
• A portion of this plasmid was derived from a plasmid made by: A portion of this plasmid was derived from a plasmid made by Feng Zhang (Addgene # 42230)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2022.08.13.503850 for bioRxiv preprint.