pLL5.0-Anillin shRNA
(Plasmid #187270)

• Purpose: Lentiviral expression of shRNA targeting Anillin
• Depositing Lab: Alpha Yap
• Publication: Budnar et al Dev Cell. 2019 Jun 17;49(6):894-906.e12. doi: 10.1016/j.devcel.2019.04.031. Epub 2019 May 16.

Backbone

• Vector backbone: pLL5.0
• Backbone size w/o insert (bp): 7568
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: shRNA for Anillin
• Alt name: Anillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra)
• gRNA/shRNA sequence: TCGGCGATGCCTCTTTGAATAAATTCAAGAGATTTATTCAAAGAGGCATCGCCATTTTTT
• Species: H. sapiens (human)
• Insert Size (bp): 60
• Entrez Gene: ANLN (a.k.a. FSGS8, Scraps, scra)
• Promoter: U6
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: mU6 Forward Primer

Resource Information

• Supplemental Documents:
  • pLL5.0-Anillin shRNA.gb
• A portion of this plasmid was derived from a plasmid made by: Plasmid made by Srikanth Budnar

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

5' cloning site: Hpa1 (destroyed), 3' cloning site: Xho1 (not destroyed).