Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRRL-pEF-H2B-mCherry-T2A-rTetR-Dest-SV40
(Plasmid #186968)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186968 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRRL
  • Backbone size w/o insert (bp) 5473
  • Total vector size (bp) 8968
  • Modifications to backbone
    Removed 3' KpnI site (after SV40)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    mCherry (fluorescence)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pEF-H2B-mCherry-T2A-rTetR-Dest-SV40
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    3546
  • Promoter EF-1alpha promoter
  • Tag / Fusion Protein
    • rTetR fusion (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site KpnI (destroyed during cloning)
  • 5′ sequencing primer cPPT-SF ATAGTAGACATAATAGCAACAGACATAC
  • 3′ sequencing primer SV40-SF GGTACCAGGTAAGTGTACCCAA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pEF-H2B-mCherry-T2A-rTetR and SV40 were amplified from pEX1-pEF-H2B-mCherry-T2A-rTetR-KRAB, a gift from M. Elowitz (Addgene #78348). The pRRL vector backbone was prepared by restriction digest of LT3REVIR, a gift from J. Zuber (Addgene #111176).
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is a destination vector for cloning a protein of interest into the reporter recruiter cassette (as a fusion to rTetR). The vector can be linearized through digestion with KpnI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL-pEF-H2B-mCherry-T2A-rTetR-Dest-SV40 was a gift from Brian Liau (Addgene plasmid # 186968 ; http://n2t.net/addgene:186968 ; RRID:Addgene_186968)
  • For your References section:

    Base editor scanning charts the DNMT3A activity landscape. Lue NZ, Garcia EM, Ngan KC, Lee C, Doench JG, Liau BB. Nat Chem Biol. 2023 Feb;19(2):176-186. doi: 10.1038/s41589-022-01167-4. Epub 2022 Oct 20. 10.1038/s41589-022-01167-4 PubMed 36266353