pRRL-pEF-H2B-mCherry-T2A-rTetR-Dest-SV40
(Plasmid #186968)

• Purpose: Lentiviral destination vector for cloning desired protein as rTetR fusion for chromatin regulation reporter (pEF-H2B-mCherry-T2A-rTetR, with SV40) for expression in mammalian cells.
• Depositing Lab: Brian Liau
• Publication: Lue et al Nat Chem Biol. 2023 Feb;19(2):176-186. doi: 10.1038/s41589-022-01167-4. Epub 2022 Oct 20.

Backbone

• Vector backbone: pRRL
• Backbone size w/o insert (bp): 5473
• Total vector size (bp): 8968
• Modifications to backbone: Removed 3' KpnI site (after SV40)
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: mCherry (fluorescence)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pEF-H2B-mCherry-T2A-rTetR-Dest-SV40
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 3546
• Promoter: EF-1alpha promoter
• Tag / Fusion Protein:
  • rTetR fusion (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: KpnI (destroyed during cloning)
• 5′ sequencing primer: cPPT-SF ATAGTAGACATAATAGCAACAGACATAC
• 3′ sequencing primer: SV40-SF GGTACCAGGTAAGTGTACCCAA

Resource Information

• Supplemental Documents:
  • pRRL-pEF-H2B-mCherry-T2A-rTetR-Dest-SV40.gb
• A portion of this plasmid was derived from a plasmid made by: pEF-H2B-mCherry-T2A-rTetR and SV40 were amplified from pEX1-pEF-H2B-mCherry-T2A-rTetR-KRAB, a gift from M. Elowitz (Addgene #78348). The pRRL vector backbone was prepared by restriction digest of LT3REVIR, a gift from J. Zuber (Addgene #111176).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is a destination vector for cloning a protein of interest into the reporter recruiter cassette (as a fusion to rTetR). The vector can be linearized through digestion with KpnI.