Rtn4b-GFP
(Plasmid #186952)

• Purpose: Expresses Rtn4b connected with C-terminus AcGFP1
• Depositing Lab: Ke Xu
• Publication: Wang et al Proc Natl Acad Sci U S A. 2022 May 3;119(18):e2117559119. doi: 10.1073/pnas.2117559119. Epub 2022 Apr 26.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5345
• Total vector size (bp): 7214
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RTN4B
• Alt name: NOGO-B
• Species: H. sapiens (human)
• Insert Size (bp): 1119
• Entrez Gene: RTN4 (a.k.a. ASY, NI220/250, NOGO, NSP, NSP-CL, Nbla00271, Nbla10545, RTN-X, RTN4-A, RTN4-B1, RTN4-B2, RTN4-C)
• Promoter: CMV Promoter
• Tag / Fusion Protein:
  • AcGFP1 (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: tagaaggcacagtcgagg

Resource Information

• Supplemental Documents:
  • pcdna3-1-nogob-gfp.gb
• A portion of this plasmid was derived from a plasmid made by: Plasmid #61807 from Addgene

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry