Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPLV_C1
(Plasmid #186415)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186415 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBEAST2
  • Backbone size w/o insert (bp) 2876
  • Total vector size (bp) 4250
  • Modifications to backbone
    Replaced the constitutive OR2-OR1-Pr promoter with the T7 promoter
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Murine RNase Inhibitor
  • Alt name
    mRI
  • Alt name
    Uniprot #Q91VI7
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1374
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCGGATACCCTTACTCTGTTGAAAAC
  • 3′ sequencing primer CACCAACGGGTTATTGATAGAACGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPLV_C1 was a gift from Jerome Bonnet (Addgene plasmid # 186415 ; http://n2t.net/addgene:186415 ; RRID:Addgene_186415)
  • For your References section:

    Evaluating and mitigating clinical samples matrix effects on TX-TL cell-free performance. Voyvodic PL, Conejero I, Mesmoudi K, Renard E, Courtet P, Cattoni DI, Bonnet J. Sci Rep. 2022 Aug 12;12(1):13785. doi: 10.1038/s41598-022-17583-4. 10.1038/s41598-022-17583-4 PubMed 35962056