Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKL2299
(Plasmid #186332)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186332 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRK2-AraE
  • Backbone manufacturer
    Brian Pfleger
  • Backbone size w/o insert (bp) 3660
  • Total vector size (bp) 29605
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    virulence genes from Agrobacterium tumefaciens pTiBo542
  • Species
    Agrobacterium tumefaciens
  • Insert Size (bp)
    25945
  • GenBank ID
    DQ058764.1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgttcggtcaaggttctgga
  • 3′ sequencing primer aacacgcctgggtcaatgat
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Qi-Jun Chen
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The vir genes were from pVS1-VIR2 (Plasmid #134745).
Zhang Q, Zhang Y, Lu MH, Chai YP, Jiang YY, Zhou Y, Wang XC, Chen QJ. A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Dec;181(4):1441-1448. doi: 10.1104/pp.19.00767.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKL2299 was a gift from Kan Wang (Addgene plasmid # 186332 ; http://n2t.net/addgene:186332 ; RRID:Addgene_186332)
  • For your References section:

    An Improved Agrobacterium-Mediated Transformation and Genome-Editing Method for Maize Inbred B104 Using a Ternary Vector System and Immature Embryos. Kang M, Lee K, Finley T, Chappell H, Veena V, Wang K. Front Plant Sci. 2022 May 4;13:860971. doi: 10.3389/fpls.2022.860971. eCollection 2022. 10.3389/fpls.2022.860971 PubMed 35599865