p223-RV-dlx-dio-Tdtomato-T2A-SYPEGFP
(Plasmid #185699)

• Purpose: Retroviral vector expression cre-dependent Tdtomato-T2A-SynaptophysinEGFP driven by the mDlx promoter
• Depositing Lab: Lynette Lim
• Publication: AAV vector using mDlx promoter (unpublished)

Backbone

• Vector backbone: addgene 87667
• Backbone manufacturer: addgene
• Backbone size w/o insert (bp): 6569
• Total vector size (bp): 3162
• Modifications to backbone: remove Synpasin promoter, replace with mDlx promoter. remove Tdtomato, remplace with Tdt-T2A-SypEGFP
• Vector type: Mammalian Expression, Retroviral, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Tdtomato,
• Alt name: Tdt
• Species: Synthetic
• Insert Size (bp): 1440
• Promoter: mDlx
• Tag / Fusion Protein:
  • T2A (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCCACATAGCGTAAAAGGAGCA

Gene/Insert 2

• Gene/Insert name: Synaptophysin-EGFP
• Alt name: SYP-EGFP
• Species: Synthetic
• Promoter: mDlx
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GTGTCCACTCCCAGTTCAATTACA

Resource Information

• Supplemental Documents:
  • p223-rv-dlx-flex-tdtomato-t2a-sypegfp.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry