pGL3Luc-5XNF-kappaB
(Plasmid #185695)

• Purpose: Reporter plasmid with a double-strand oligonucleotides that contain five repeats of NF-kappaB binding consensus sequence (5'-GGGGAATTTCC-3').
• Depositing Lab: Esther López-Bayghen
• Publication: Hernandez-Melchor et al ASN Neuro. 2022 Jan-Dec;14:17590914221116574. doi: 10.1177/17590914221116574.

Backbone

• Vector backbone: pGL3promoter
• Backbone size w/o insert (bp): 5010
• Total vector size (bp): 5099
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NF-kappaB
• Alt name: NFkB
• Species: H. sapiens (human)
• Insert Size (bp): 88
• GenBank ID: U47298
• Entrez Gene: NFKB1 (a.k.a. CVID12, EBP-1, KBF1, NF-kB, NF-kB1, NF-kappa-B1, NF-kappaB, NF-kappabeta, NFKB-p105, NFKB-p50, NFkappaB)
• Promoter: NF-kappaB binding site

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (not destroyed)
• 3′ cloning site: SmaI (unknown if destroyed)
• 5′ sequencing primer: CTAGCAAAATAGGCTGTCCC
• 3′ sequencing primer: CTTTATGTTTTTGGCGTCTTCCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry