Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right}
(Plasmid #184381)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184381 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    n/a
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9, two gRNAs targeting dystrophin
  • gRNA/shRNA sequence
    TCTTTGAAAGAGCAATAAAA, ATTTCAGGTAAGCCGAGGTT
  • Species
    M. musculus (mouse)

Cloning Information

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid was generated by VectorBuilder, ID: VB190715-1035jad

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right} was a gift from Ori Bar-Nur (Addgene plasmid # 184381 ; http://n2t.net/addgene:184381 ; RRID:Addgene_184381)
  • For your References section:

    CRISPR/Cas9 editing of directly reprogrammed myogenic progenitors restores dystrophin expression in a mouse model of muscular dystrophy. Domenig SA, Bundschuh N, Lenardic A, Ghosh A, Kim I, Qabrati X, D'Hulst G, Bar-Nur O. Stem Cell Reports. 2022 Feb 8;17(2):321-336. doi: 10.1016/j.stemcr.2021.12.003. Epub 2022 Jan 6. 10.1016/j.stemcr.2021.12.003 PubMed 34995499