Skip to main content
Addgene

Ki67∆repeats-mNeonGreen-IRESpuro2
(Plasmid #183742)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183742 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pIRESpuro2
  • Backbone size w/o insert (bp) 5091
  • Total vector size (bp) 9738
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MKI67(lacking repeats)
  • Species
    H. sapiens (human)
  • Mutation
    MKI67(lacking repeats)
  • Entrez Gene
    MKI67 (a.k.a. KIA, MIB-, MIB-1, PPP1R105)
  • Promoter CMV
  • Tag / Fusion Protein
    • mNeonGreen (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstBI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CAGAGCTGGTTTAGTGAACC
  • 3′ sequencing primer ATTCCAGCACACTGGATCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ki67∆repeats-mNeonGreen-IRESpuro2 was a gift from Daniel Gerlich (Addgene plasmid # 183742 ; http://n2t.net/addgene:183742 ; RRID:Addgene_183742)
  • For your References section:

    Ki-67 acts as a biological surfactant to disperse mitotic chromosomes. Cuylen S, Blaukopf C, Politi AZ, Muller-Reichert T, Neumann B, Poser I, Ellenberg J, Hyman AA, Gerlich DW. Nature. 2016 Jun 29;535(7611):308-12. doi: 10.1038/nature18610. 10.1038/nature18610 PubMed 27362226