pDRM55 tet-AR(1-707)
(Plasmid #183503)

• Purpose: Lentiviral vector expressing a doxycycline-inducible constitutively active truncated androgen receptor (wild type AR)
• Depositing Lab: Wayne Tilley
• Publication: Hickey et al Nat Med. 2021 Feb;27(2):310-320. doi: 10.1038/s41591-020-01168-7. Epub 2021 Jan 18.

Backbone

• Vector backbone: pCW57.1
• Backbone manufacturer: David Root (Addgene plasmid # 41393)
• Backbone size w/o insert (bp): 7705
• Total vector size (bp): 9829
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Androgen receptor
• Alt name: AR
• Species: H. sapiens (human)
• Insert Size (bp): 2124
• Mutation: Constitutively active truncated AR; spans AR 1-707 aa.
• Entrez Gene: AR (a.k.a. AIS, AR8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM)
• Promoter: CMV

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CMV F (GAGCTCGTTTAGTGAACCGTC)
• 3′ sequencing primer: hPGK R (CCCAGGGCTGCCTTGGAAAAG)

Resource Information

• Supplemental Documents:
  • pDRM55 tet-AR(1-707).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains 2x Gln insertion at Q77, a R211A mutation, and Gly 467-470 deletion in AR(1-707). These differences are not known to affect plasmid function.