Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDRM55 tet-AR(1-707)
(Plasmid #183503)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183503 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    David Root (Addgene plasmid # 41393)
  • Backbone size w/o insert (bp) 7705
  • Total vector size (bp) 9829
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Androgen receptor
  • Alt name
    AR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2124
  • Mutation
    Constitutively active truncated AR; spans AR 1-707 aa.
  • Entrez Gene
    AR (a.k.a. AIS, AR8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM)
  • Promoter CMV

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CMV F (GAGCTCGTTTAGTGAACCGTC)
  • 3′ sequencing primer hPGK R (CCCAGGGCTGCCTTGGAAAAG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains 2x Gln insertion at Q77, a R211A mutation, and Gly 467-470 deletion in AR(1-707). These differences are not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDRM55 tet-AR(1-707) was a gift from Wayne Tilley (Addgene plasmid # 183503 ; http://n2t.net/addgene:183503 ; RRID:Addgene_183503)
  • For your References section:

    The androgen receptor is a tumor suppressor in estrogen receptor-positive breast cancer. Hickey TE, Selth LA, Chia KM, Laven-Law G, Milioli HH, Roden D, Jindal S, Hui M, Finlay-Schultz J, Ebrahimie E, Birrell SN, Stelloo S, Iggo R, Alexandrou S, Caldon CE, Abdel-Fatah TM, Ellis IO, Zwart W, Palmieri C, Sartorius CA, Swarbrick A, Lim E, Carroll JS, Tilley WD. Nat Med. 2021 Feb;27(2):310-320. doi: 10.1038/s41591-020-01168-7. Epub 2021 Jan 18. 10.1038/s41591-020-01168-7 PubMed 33462444