Skip to main content
Addgene

pDRM56 tet-AR(1-707)C617Y
(Plasmid #183504)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183504 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    David Root (Addgene plasmid # 41393)
  • Backbone size w/o insert (bp) 7705
  • Total vector size (bp) 9829
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Androgen receptor
  • Alt name
    AR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2124
  • Mutation
    Truncated mutant AR; spans AR 1-707 aa, and contains a C617Y loss-of-function mutation in the DNA binding domain (c.1850 G>A)
  • Entrez Gene
    AR (a.k.a. AIS, AR8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM)
  • Promoter CMV

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CMV F (GAGCTCGTTTAGTGAACCGTC)
  • 3′ sequencing primer hPGK R (CCCAGGGCTGCCTTGGAAAAG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Pair with pDRM55 (Addgene #183503)for comparative studies.

Please note: Plasmid contains a R211A mutation and Gly 466-470 deletion in AR(1-707)C617Y. These differences are not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDRM56 tet-AR(1-707)C617Y was a gift from Wayne Tilley (Addgene plasmid # 183504 ; http://n2t.net/addgene:183504 ; RRID:Addgene_183504)
  • For your References section:

    The androgen receptor is a tumor suppressor in estrogen receptor-positive breast cancer. Hickey TE, Selth LA, Chia KM, Laven-Law G, Milioli HH, Roden D, Jindal S, Hui M, Finlay-Schultz J, Ebrahimie E, Birrell SN, Stelloo S, Iggo R, Alexandrou S, Caldon CE, Abdel-Fatah TM, Ellis IO, Zwart W, Palmieri C, Sartorius CA, Swarbrick A, Lim E, Carroll JS, Tilley WD. Nat Med. 2021 Feb;27(2):310-320. doi: 10.1038/s41591-020-01168-7. Epub 2021 Jan 18. 10.1038/s41591-020-01168-7 PubMed 33462444