pDRM56 tet-AR(1-707)C617Y
(Plasmid
#183504)
-
PurposeLentiviral vector expressing a doxycycline-inducible truncated DNA-binding mutant androgen receptor (AR mutant C617Y)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183504 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerDavid Root (Addgene plasmid # 41393)
- Backbone size w/o insert (bp) 7705
- Total vector size (bp) 9829
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAndrogen receptor
-
Alt nameAR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2124
-
MutationTruncated mutant AR; spans AR 1-707 aa, and contains a C617Y loss-of-function mutation in the DNA binding domain (c.1850 G>A)
-
Entrez GeneAR (a.k.a. AIS, AR8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM)
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMV F (GAGCTCGTTTAGTGAACCGTC)
- 3′ sequencing primer hPGK R (CCCAGGGCTGCCTTGGAAAAG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Pair with pDRM55 (Addgene #183503)for comparative studies.
Please note: Plasmid contains a R211A mutation and Gly 466-470 deletion in AR(1-707)C617Y. These differences are not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDRM56 tet-AR(1-707)C617Y was a gift from Wayne Tilley (Addgene plasmid # 183504 ; http://n2t.net/addgene:183504 ; RRID:Addgene_183504) -
For your References section:
The androgen receptor is a tumor suppressor in estrogen receptor-positive breast cancer. Hickey TE, Selth LA, Chia KM, Laven-Law G, Milioli HH, Roden D, Jindal S, Hui M, Finlay-Schultz J, Ebrahimie E, Birrell SN, Stelloo S, Iggo R, Alexandrou S, Caldon CE, Abdel-Fatah TM, Ellis IO, Zwart W, Palmieri C, Sartorius CA, Swarbrick A, Lim E, Carroll JS, Tilley WD. Nat Med. 2021 Feb;27(2):310-320. doi: 10.1038/s41591-020-01168-7. Epub 2021 Jan 18. 10.1038/s41591-020-01168-7 PubMed 33462444