C321.∆A T7RNAP
(Bacterial strain
#182776)
-
PurposeRecoded E. coli MG1655 strain with UAG termination function removed (RF1 is deleted); T7RNAP cassette genomically inserted
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 182776 | Bacteria in agar stab | 1 | $85 |
Backbone
-
Vector backbonenone
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)This is a strain.
-
Growth instructionsGrowth temperature: 32°C
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameT7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAACTTAATGCAACACACCA, CGTGTGCGTGTCCATAGA
- 3′ sequencing primer CCGCGCTTAGCTTTCACT, GGTGAAGCACGCTTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
C321.∆A T7RNAP was a gift from Michael Jewett (Addgene plasmid # 182776) -
For your References section:
Improving genomically recoded Escherichia coli to produce proteins containing non-canonical amino acids. Perez JG, Carlson ED, Weisser O, Kofman C, Seki K, Des Soye BJ, Karim AS, Jewett MC. Biotechnol J. 2021 Dec 11:e2100330. doi: 10.1002/biot.202100330. 10.1002/biot.202100330 PubMed 34894206