PB-TO-NGN2-EMX1 BSD-mApple
(Plasmid
#182311)
-
PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 and EMX1 expression, bsd selection, mApple
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182311 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUCM
- Backbone size w/o insert (bp) 13078
- Total vector size (bp) 14788
-
Modifications to backboneCAG-rtTA3G-polyA
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer ccgtaccacttcctaccctc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namebsd-T2A-mycNLS-mApple
-
Insert Size (bp)1326
- Promoter EF1a
-
Tag
/ Fusion Protein
- T2A-mycNLS-mApple
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SwaI (not destroyed)
- 3′ cloning site N/A (unknown if destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMichael Ward lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TO-NGN2-EMX1 BSD-mApple was a gift from iPSC Neurodegenerative Disease Initiative (iNDI) & Michael Ward (Addgene plasmid # 182311 ; http://n2t.net/addgene:182311 ; RRID:Addgene_182311)