PB-TO-oNGN2
(Plasmid
#198397)
-
PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expression. oNGN2 is a Phospho-mutant which avoids inhibition by cdk kinase, NGN2 optimization aided by IDT tool.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUCM
- Backbone size w/o insert (bp) 13243
- Total vector size (bp) 14098
-
Modifications to backbonex y z
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions100µg/mL
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameNEUROG2 (phospho mutant, codon optimized)
-
Alt namehNGN2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)819
-
MutationS24A, S193A, S207A, S209A, S219A, S232A, S239A, S242A
-
Entrez GeneNEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
- Promoter TRE3G
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHi (not destroyed)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer ccgtaccacttcctaccctc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepuroR-T2A-mycNLS-mTagBFP2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1476
- Promoter EF1a
-
Tag
/ Fusion Protein
- T2A-mycNLS-mTagBFP2
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SwaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namertTA3G
-
SpeciesH. sapiens (human)
-
Insert Size (bp)748
- Promoter CAG
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer ctggttattgtgctgtctc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TO-oNGN2 was a gift from iPSC Neurodegenerative Disease Initiative (iNDI) & Michael Ward (Addgene plasmid # 198397 ; http://n2t.net/addgene:198397 ; RRID:Addgene_198397)