-
PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into astrocytes via NFIA and SOX9 expression
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182306 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUCM
- Backbone size w/o insert (bp) 13000
- Total vector size (bp) 16660
-
Vector typeMammalian Expression ; PiggyBac
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameNFIA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1530
-
Entrez GeneNFIA (a.k.a. BRMUTD, CTF, NF-I/A, NF1-A, NFI-A, NFI-L)
- Promoter TRE3G-Bi-directional
-
Tag
/ Fusion Protein
- None
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (not destroyed)
- 3′ cloning site NruI (not destroyed)
- 5′ sequencing primer ccgtaccacttcctaccctc
- 3′ sequencing primer caagttggggtgggcgat (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSOX9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1527
-
Entrez GeneSOX9 (a.k.a. CMD1, CMPD1, SRA1, SRXX2, SRXY10)
- Promoter TRE3G-Bi-directional
-
Tag
/ Fusion Protein
- None
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site AvrII (not destroyed)
- 5′ sequencing primer atgtggcttgagctgtaggc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namepuroR-T2A-mycNLS-mTagBFP2
-
Insert Size (bp)1473
-
Tag
/ Fusion Protein
- T2A-mycNLS-mTagBFP2
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMichael Ward lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TO-NFIA.1-SOX9 (bi-directional promoter) was a gift from iPSC Neurodegenerative Disease Initiative (iNDI) & Michael Ward (Addgene plasmid # 182306 ; http://n2t.net/addgene:182306 ; RRID:Addgene_182306)