PB-TO-NFIA.1-SOX9 (bi-directional promoter)
(Plasmid #182306)

• Purpose: Piggybac Tet-ON plasmid for differentiating hiPSCs into astrocytes via NFIA and SOX9 expression
• Depositing Labs: iPSC Neurodegenerative Disease Initiative (iNDI), Michael Ward
• Publication: Characterization of iPSC lines for the iPSC Neurodegenerative Disease Initiative (iNDI) (unpublished)

Backbone

• Vector backbone: pUCM
• Backbone size w/o insert (bp): 13000
• Total vector size (bp): 16660
• Vector type: Mammalian Expression ; PiggyBac
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: NFIA
• Species: H. sapiens (human)
• Insert Size (bp): 1530
• Entrez Gene: NFIA (a.k.a. BRMUTD, CTF, NF-I/A, NF1-A, NFI-A, NFI-L)
• Promoter: TRE3G-Bi-directional
• Tag / Fusion Protein:
  • None

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: PmeI (not destroyed)
• 3′ cloning site: NruI (not destroyed)
• 5′ sequencing primer: ccgtaccacttcctaccctc
• 3′ sequencing primer: caagttggggtgggcgat

Gene/Insert 2

• Gene/Insert name: SOX9
• Species: H. sapiens (human)
• Insert Size (bp): 1527
• Entrez Gene: SOX9 (a.k.a. CMD1, CMPD1, SRA1, SRXX2, SRXY10)
• Promoter: TRE3G-Bi-directional
• Tag / Fusion Protein:
  • None

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: AvrII (not destroyed)
• 5′ sequencing primer: atgtggcttgagctgtaggc

Gene/Insert 3

• Gene/Insert name: puroR-T2A-mycNLS-mTagBFP2
• Insert Size (bp): 1473
• Tag / Fusion Protein:
  • T2A-mycNLS-mTagBFP2

Resource Information

• Supplemental Documents:
  • K2-PB-TO-NFIA.1-SOX9.gbk
• A portion of this plasmid was derived from a plasmid made by: Michael Ward lab

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry