pC0090
(Plasmid #181954)

• Purpose: Beta catenin reporter M50 Super 8x (TCF/LEF binding sites) TOPFlash with Gluc/Cluc
• Depositing Lab: Feng Zhang
• Publication: Abudayyeh et al Science. 2019 Jul 11. pii: science.aax7063. doi: 10.1126/science.aax7063.

Backbone

• Vector backbone: pC0037
• Backbone size w/o insert (bp): 6957
• Total vector size (bp): 6309
• Modifications to backbone: Replaced EF1alpha promoter with 7xTOPFlash/minimal promoter
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 7xTOPFlash
• Alt name: 7xTOP binding site
• Species: Synthetic
• Insert Size (bp): 149

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ctagcaaaataggctgtccc

Resource Information

• Supplemental Documents:
  • pab1426-m50-super-8x-topflash-with-gluccluc.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene Plasmid #12456

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

From:
Veeman MT, Slusarski DC, Kaykas A, Louie SH, Moon RT. Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation movements. Curr Biol. 2003 Apr 15;13(8):680-5. doi: 10.1016/s0960-9822(03)00240-9. PMID: 12699626.