pC0091
(Plasmid
#181955)
-
PurposeBeta catenin reporter control M51 Super 8x (mutated TCF/LEF binding sites) FOPFlash with Gluc/Cluc
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 181955 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepC0037
- Backbone size w/o insert (bp) 6957
- Total vector size (bp) 6309
-
Modifications to backboneReplaced EF1alpha promoter with 7xFOP/minimal promoter
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name7xFOP
-
Alt nameMutant 7xTOP binding site
-
SpeciesSynthetic
-
Insert Size (bp)149
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctagcaaaataggctgtccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene Plasmid #12457
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
From:
Veeman MT, Slusarski DC, Kaykas A, Louie SH, Moon RT. Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation movements. Curr Biol. 2003 Apr 15;13(8):680-5. doi: 10.1016/s0960-9822(03)00240-9. PMID: 12699626.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC0091 was a gift from Feng Zhang (Addgene plasmid # 181955 ; http://n2t.net/addgene:181955 ; RRID:Addgene_181955) -
For your References section:
A cytosine deaminase for programmable single-base RNA editing. Abudayyeh OO, Gootenberg JS, Franklin B, Koob J, Kellner MJ, Ladha A, Joung J, Kirchgatterer P, Cox DBT, Zhang F. Science. 2019 Jul 11. pii: science.aax7063. doi: 10.1126/science.aax7063. 10.1126/science.aax7063 PubMed 31296651