pAAV-EGFP.T2A.NCLX
(Plasmid #181873)

• Purpose: Expresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoter
• Depositing Lab: Hilmar Bading
• Publication: Hagenston et al J Biol Chem. 2021 Dec 20:101508. doi: 10.1016/j.jbc.2021.101508.

Backbone

• Vector backbone: pAAV-CAG
• Vector type: Mammalian Expression, Adenoviral, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: solute carrier family 8 member B1
• Alt name: NCLX
• Alt name: sodium/calcium/lithium exchanger
• Species: M. musculus (mouse)
• Insert Size (bp): 1755
• GenBank ID: NM_133221
• Entrez Gene: Slc8a1 (a.k.a. D930008O12Rik, Ncx1)
• Promoter: synthetic hybrid CAG promoter (follows a T2A signal after EGFP)
• Tag / Fusion Protein:
  • myc (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (destroyed during cloning)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GATCACATGGTCCTGCTG
• 3′ sequencing primer: ACGGGAAGCAATAGCATGATAC

Gene/Insert 2

• Gene/Insert name: EGFP
• Alt name: enhanced GFP
• Insert Size (bp): 717
• Promoter: synthetic hybrid CAG promoter
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: TTCGGCTTCTGGCGTGTGA

Resource Information

• Supplemental Documents:
  • 281_CAG-EGFP.HA.T2A.wt(Ms)NCLX.myc.gbk
• A portion of this plasmid was derived from a plasmid made by: Israel Sekler, Department of Physiology and Cell Biology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry