pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
(Plasmid
#181745)
-
Purposedual T7 promoter vector for bacterial expression of SpCas9 with a c-terminal NLS and 3xFLAG tag, along with an SpCas9 sgRNA targeting EGFP site 1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 181745 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneBPK764 (Addgene Plasmid #65767)
-
Vector typeBacterial Expression ; in vitro transcription; T7 promoter
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehuman/zebrafish codon optimized SpCas9
-
Alt nameBPK848
-
gRNA/shRNA sequenceGGGCACGGGCAGCTTGCCGG
-
SpeciesSynthetic
- Promoter T7
-
Tag
/ Fusion Protein
- NLS(SV40)-3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer oBK311-GCCATTCGATGGTGTCCGG
- 3′ sequencing primer oBK390-GCAAATTCGACCCGGTCGTCG Chloramphenicol (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848) was a gift from Benjamin Kleinstiver (Addgene plasmid # 181745 ; http://n2t.net/addgene:181745 ; RRID:Addgene_181745) -
For your References section:
Precise DNA cleavage using CRISPR-SpRYgests. Christie KA, Guo JA, Silverstein RA, Doll RM, Mabuchi M, Stutzman HE, Lin J, Ma L, Walton RT, Pinello L, Robb GB, Kleinstiver BP. Nat Biotechnol. 2022 Oct 6. pii: 10.1038/s41587-022-01492-y. doi: 10.1038/s41587-022-01492-y. 10.1038/s41587-022-01492-y PubMed 36203014