pHR-SV40-mCherry-SHP1 (SHP2-cSH2)
(Plasmid
#180822)
-
PurposeExpression of N-terminal mCherry tagged human SHP1 with its cSH2 replaced by SHP2-cSH2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180822 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cagggacagcagagatccagtttg
- 3′ sequencing primer ccagaggttgattatcgataagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-SV40-mCherry-SHP1 (SHP2-cSH2) was a gift from Enfu Hui (Addgene plasmid # 180822 ; http://n2t.net/addgene:180822 ; RRID:Addgene_180822) -
For your References section:
Molecular features underlying differential SHP1/SHP2 binding of immune checkpoint receptors. Xu X, Masubuchi T, Cai Q, Zhao Y, Hui E. Elife. 2021 Nov 4;10. pii: 74276. doi: 10.7554/eLife.74276. 10.7554/eLife.74276 PubMed 34734802