Skip to main content
Addgene

pHR-SV40-mCherry-SHP1 (SHP2-cSH2)
(Plasmid #180822)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180822 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SHP1 (SHP2-cSH2)
  • Species
    H. sapiens (human)
  • Entrez Gene
    PTPN6 (a.k.a. HCP, HCPH, HPTP1C, PTP-1C, SH-PTP1, SHP-1, SHP-1L, SHP1)
  • Entrez Gene
    PTPN11 (a.k.a. BPTP3, CFC, JMML, METCDS, NS1, PTP-1D, PTP2C, SH-PTP2, SH-PTP3, SHP2)
  • Promoter SV40

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cagggacagcagagatccagtttg
  • 3′ sequencing primer ccagaggttgattatcgataagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-SV40-mCherry-SHP1 (SHP2-cSH2) was a gift from Enfu Hui (Addgene plasmid # 180822 ; http://n2t.net/addgene:180822 ; RRID:Addgene_180822)
  • For your References section:

    Molecular features underlying differential SHP1/SHP2 binding of immune checkpoint receptors. Xu X, Masubuchi T, Cai Q, Zhao Y, Hui E. Elife. 2021 Nov 4;10. pii: 74276. doi: 10.7554/eLife.74276. 10.7554/eLife.74276 PubMed 34734802