Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLX-TRV2
(Plasmid #180516)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180516 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLX-B2
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tobacco rattle virus RNA2 with a PEBV heterologous promoter and a polylinker
  • Insert Size (bp)
    6243
  • Promoter 35S CaMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGGTGGCAGGATATATTGTGG
  • 3′ sequencing primer ATATATCCTGCCATCAGTCATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX-TRV2 was a gift from Jose-Antonio Daros (Addgene plasmid # 180516 ; http://n2t.net/addgene:180516 ; RRID:Addgene_180516)
  • For your References section:

    Simplifying plant gene silencing and genome editing logistics by a one-Agrobacterium system for simultaneous delivery of multipartite virus vectors. Aragones V, Aliaga F, Pasin F, Daros JA. Biotechnol J. 2022 Mar 24:e2100504. doi: 10.1002/biot.202100504. 10.1002/biot.202100504 PubMed 35332696