Skip to main content
Addgene

pLX-TRV1
(Plasmid #180515)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180515 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLX-Z4
  • Total vector size (bp) 10774
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Tobacco rattle virus RNA1
  • Promoter 35S CaMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGCAGCGGCAGGATATATGGC
  • 3′ sequencing primer ATATATCCTGCCATCAGTCATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX-TRV1 was a gift from Jose-Antonio Daros (Addgene plasmid # 180515 ; http://n2t.net/addgene:180515 ; RRID:Addgene_180515)
  • For your References section:

    Simplifying plant gene silencing and genome editing logistics by a one-Agrobacterium system for simultaneous delivery of multipartite virus vectors. Aragones V, Aliaga F, Pasin F, Daros JA. Biotechnol J. 2022 Mar 24:e2100504. doi: 10.1002/biot.202100504. 10.1002/biot.202100504 PubMed 35332696