W118-1_hTGM2_C277S-Flag
(Plasmid #180412)

• Purpose: lentiviral transduction of human TGM2 transcript variant 2 with a point mutation (C277S) that inactivate the enzyme and also with a C-terminal Flag tag
• Depositing Lab: Huda Zoghbi
• Publication: Lee et al J Clin Invest. 2022 May 2;132(9). pii: 156616. doi: 10.1172/JCI156616.

Backbone

• Vector backbone: W118-1
• Backbone size w/o insert (bp): 8015
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: TGM2_C277S
• Species: H. sapiens (human)
• Insert Size (bp): 1677
• Mutation: C277S
• Entrez Gene: TGM2 (a.k.a. G(h), TG(C), TGC, hTG2, tTG)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CMV forward
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry