W118-1_hTGM6-Flag
(Plasmid
#180411)
-
Purposelentiviral transduction of human TGM6 (with a C-terminal Flag tag) gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180411 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneW118-1
- Backbone size w/o insert (bp) 8015
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTGM6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2151
-
Entrez GeneTGM6 (a.k.a. SCA35, TG6, TGM3L, TGY, dJ734P14.3)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMV forward
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
W118-1_hTGM6-Flag was a gift from Huda Zoghbi (Addgene plasmid # 180411 ; http://n2t.net/addgene:180411 ; RRID:Addgene_180411) -
For your References section:
Cross-species genetic screens identify transglutaminase 5 as a regulator of polyglutamine-expanded ataxin-1. Lee WS, Al-Ramahi I, Jeong HH, Jang Y, Lin T, Adamski CJ, Lavery LA, Rath S, Richman R, Bondar VV, Alcala E, Revelli JP, Orr HT, Liu Z, Botas J, Zoghbi HY. J Clin Invest. 2022 May 2;132(9). pii: 156616. doi: 10.1172/JCI156616. 10.1172/JCI156616 PubMed 35499073