Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV.CBA.YFP.miR-E_shIrak1-3
(Plasmid #180399)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 180399 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV.CBA.YFP.miR-E
  • Backbone size w/o insert (bp) 6337
  • Vector type
    AAV, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shIrak1-3
  • gRNA/shRNA sequence
    ATATGGTGAAACAGAGCTTCTT
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    97
  • Entrez Gene
    Irak1 (a.k.a. AA408924, IRA, IRAK, IRAK-1, IRAK1-S, IRAK1b, Il, Il1rak, Plpk, mP, mPLK)
  • Promoter CBA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTACCTGAGCTACCAGTCC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV.CBA.YFP.miR-E_shIrak1-3 was a gift from Huda Zoghbi (Addgene plasmid # 180399 ; http://n2t.net/addgene:180399 ; RRID:Addgene_180399)
  • For your References section:

    Cross-species genetic screens identify transglutaminase 5 as a regulator of polyglutamine-expanded ataxin-1. Lee WS, Al-Ramahi I, Jeong HH, Jang Y, Lin T, Adamski CJ, Lavery LA, Rath S, Richman R, Bondar VV, Alcala E, Revelli JP, Orr HT, Liu Z, Botas J, Zoghbi HY. J Clin Invest. 2022 May 2;132(9). pii: 156616. doi: 10.1172/JCI156616. 10.1172/JCI156616 PubMed 35499073