AAV.CBA.YFP.miR-E_shIrak1-1
(Plasmid
#180397)
-
PurposeProducing AAV that encodes mouse Irak1 shRNA-1 with miR-E backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV.CBA.YFP.miR-E
- Backbone size w/o insert (bp) 6337
-
Vector typeAAV, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshIrak1-1
-
gRNA/shRNA sequenceACCGGGCTATTCAGTTTTTACA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)97
-
Entrez GeneIrak1 (a.k.a. AA408924, IRA, IRAK, IRAK-1, IRAK1-S, IRAK1b, Il, Il1rak, Plpk, mP, mPLK)
- Promoter CBA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTACCTGAGCTACCAGTCC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV.CBA.YFP.miR-E_shIrak1-1 was a gift from Huda Zoghbi (Addgene plasmid # 180397 ; http://n2t.net/addgene:180397 ; RRID:Addgene_180397) -
For your References section:
Cross-species genetic screens identify transglutaminase 5 as a regulator of polyglutamine-expanded ataxin-1. Lee WS, Al-Ramahi I, Jeong HH, Jang Y, Lin T, Adamski CJ, Lavery LA, Rath S, Richman R, Bondar VV, Alcala E, Revelli JP, Orr HT, Liu Z, Botas J, Zoghbi HY. J Clin Invest. 2022 May 2;132(9). pii: 156616. doi: 10.1172/JCI156616. 10.1172/JCI156616 PubMed 35499073