AAV.CBA.YFP.miR-E_shTgm5-2
(Plasmid #180395)

• Purpose: Producing AAV that encodes mouse Tgm5 shRNA-2 with miR-E backbone
• Depositing Lab: Huda Zoghbi
• Publication: Lee et al J Clin Invest. 2022 May 2;132(9). pii: 156616. doi: 10.1172/JCI156616.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV.CBA.YFP.miR-E
• Backbone size w/o insert (bp): 6337
• Vector type: AAV, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: shTgm5-2
• gRNA/shRNA sequence: CCACCAGGACACAGCTACTGTA
• Species: M. musculus (mouse)
• Insert Size (bp): 97
• Entrez Gene: Tgm5 (a.k.a. TGx, TGMX, MGC143848, MGC143849, 2310007C07Rik)
• Promoter: CBA

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACTACCTGAGCTACCAGTCC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry