pcDNA3.1/Puro-CAG-JEDI-2P-Kv
(Plasmid
#179462)
-
PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P expressed under strong mammalian promoter (CAG)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1/Puro-CAG
- Backbone size w/o insert (bp) 6095
- Total vector size (bp) 7610
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418), Puromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJEDI-2P-Kv
-
Alt nameJEDI2P-Kv
-
SpeciesSynthetic
-
Insert Size (bp)1515
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1/Puro-CAG-JEDI-2P-Kv was a gift from Francois St-Pierre (Addgene plasmid # 179462 ; http://n2t.net/addgene:179462 ; RRID:Addgene_179462) -
For your References section:
Sustained deep-tissue voltage recording using a fast indicator evolved for two-photon microscopy. Liu Z, Lu X, Villette V, Gou Y, Colbert KL, Lai S, Guan S, Land MA, Lee J, Assefa T, Zollinger DR, Korympidou MM, Vlasits AL, Pang MM, Su S, Cai C, Froudarakis E, Zhou N, Patel SS, Smith CL, Ayon A, Bizouard P, Bradley J, Franke K, Clandinin TR, Giovannucci A, Tolias AS, Reimer J, Dieudonne S, St-Pierre F. Cell. 2022 Aug 16. pii: S0092-8674(22)00916-3. doi: 10.1016/j.cell.2022.07.013. 10.1016/j.cell.2022.07.013 PubMed 35985322