GFP-LacI-HIPK2
(Plasmid
#179269)
-
PurposeExpresses GFP-LacI-HIPK2 fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179269 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneGFP-LacI-polylinker
- Backbone size w/o insert (bp) 7304
- Total vector size (bp) 10862
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehomeodomain interacting protein kinase 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3576
-
GenBank IDNM_022740.5
-
Entrez GeneHIPK2 (a.k.a. PRO0593)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP-LacI (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GTGAAGGGCAATCAGCTGTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-LacI-HIPK2 was a gift from Lienhard Schmitz (Addgene plasmid # 179269 ; http://n2t.net/addgene:179269 ; RRID:Addgene_179269) -
For your References section:
Chromatin Targeting of HIPK2 Leads to Acetylation-Dependent Chromatin Decondensation. Haas J, Bloesel D, Bacher S, Kracht M, Schmitz ML. Front Cell Dev Biol. 2020 Sep 1;8:852. doi: 10.3389/fcell.2020.00852. eCollection 2020. 10.3389/fcell.2020.00852 PubMed 32984337