MDH1-shDusp5-2-H2Kb2
(Plasmid
#17853)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17853 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMDH1-404-H2Kb2
-
Backbone manufacturerChen lab
- Backbone size w/o insert (bp) 8200
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshDusp5
-
Alt nameDusp5
-
SpeciesH. sapiens (human)
-
Entrez GeneDUSP5 (a.k.a. DUSP, HVH3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site See map (not destroyed)
- 3′ cloning site See map (not destroyed)
- 5′ sequencing primer H1 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Target region of DUSP5: CAAGGGGAGGCAGCCAGCTCCACGTTTAT (XM_140740: 1197-1225, CDS).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MDH1-shDusp5-2-H2Kb2 was a gift from Chang-Zheng Chen (Addgene plasmid # 17853 ; http://n2t.net/addgene:17853 ; RRID:Addgene_17853) -
For your References section:
miR-181a is an intrinsic modulator of T cell sensitivity and selection. Li QJ, Chau J, Ebert PJ, Sylvester G, Min H, Liu G, Braich R, Manoharan M, Soutschek J, Skare P, Klein LO, Davis MM, Chen CZ. Cell. 2007 Apr 6. 129(1):147-61. 10.1016/j.cell.2007.03.008 PubMed 17382377