hRAP-pEZT-BM
(Plasmid #177986)

• Purpose: Expression human RAP containing a C-terminal 6xHis tag in mammalian cells
• Depositing Lab: Lora Hooper
• Publication: Bang et al Science. 2021 Sep 17;373(6561):eabf9232. doi: 10.1126/science.abf9232. Epub 2021 Sep 17.

Backbone

• Vector backbone: pEZT-BM
• Backbone manufacturer: Ryan Hibbs
• Backbone size w/o insert (bp): 7427
• Total vector size (bp): 8519
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LDL receptor related protein associated protein 1
• Alt name: LRPAP1
• Alt name: RAP
• Species: H. sapiens (human)
• Insert Size (bp): 1092
• GenBank ID: NM_002337
• Entrez Gene: LRPAP1 (a.k.a. A2MRAP, A2RAP, HBP44, MRAP, MYP23, RAP, alpha-2-MRAP)
• Promoter: CMV
• Tag / Fusion Protein:
  • 6xHis (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CACTCCCAGTTCAATTAC
• 3′ sequencing primer: ACAAATTTTGTAATCCAGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry