hLRP1-pEZT-BM
(Plasmid #177985)

• Purpose: Expression the full-length ectodomain of human LRP1 [residue 1-4414] in mammalian cells
• Depositing Lab: Lora Hooper
• Publication: Bang et al Science. 2021 Sep 17;373(6561):eabf9232. doi: 10.1126/science.abf9232. Epub 2021 Sep 17.

Backbone

• Vector backbone: pEZT-BM
• Backbone manufacturer: Ryan Hibbs
• Backbone size w/o insert (bp): 7427
• Total vector size (bp): 20672
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LDL receptor related protein 1
• Alt name: LRP1
• Species: H. sapiens (human)
• Insert Size (bp): 13245
• GenBank ID: NM_002332
• Entrez Gene: LRP1 (a.k.a. A2MR, APOER, APR, CD91, IGFBP-3R, IGFBP3R, IGFBP3R1, KPA, LRP, LRP1A, TGFBR5)
• Promoter: CMV
• Tag / Fusion Protein:
  • No

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: Not1 (not destroyed)
• 5′ sequencing primer: CACTCCCAGTTCAATTAC
• 3′ sequencing primer: ACAAATTTTGTAATCCAGAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Joachim Herz

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry