CRISPR-SB
(Plasmid
#177936)
-
Purpose(Empty Backbone) Expresses SpCas9 and sgRNA. Can be integrated into the genome upon co-delivery of Sleeping Beauty transposase.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepx330
-
Vector typeMammalian Expression, CRISPR ; Transposon
- Promoter U6
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRISPR-SB was a gift from Roland Rad (Addgene plasmid # 177936 ; http://n2t.net/addgene:177936 ; RRID:Addgene_177936) -
For your References section:
CRISPR somatic genome engineering and cancer modeling in the mouse pancreas and liver. Kaltenbacher T, Loprich J, Maresch R, Weber J, Muller S, Oellinger R, Gross N, Griger J, de Andrade Kratzig N, Avramopoulos P, Ramanujam D, Brummer S, Widholz SA, Barthel S, Falcomata C, Pfaus A, Alnatsha A, Mayerle J, Schmidt-Supprian M, Reichert M, Schneider G, Ehmer U, Braun CJ, Saur D, Engelhardt S, Rad R. Nat Protoc. 2022 Apr;17(4):1142-1188. doi: 10.1038/s41596-021-00677-0. Epub 2022 Mar 14. 10.1038/s41596-021-00677-0 PubMed 35288718