pFAST-BAC BAF155/SMARCC1-His
(Plasmid
#177863)
-
PurposeTransfer vector to generate recombinant baculovirus expressing BAF155/SMARCC1-His
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177863 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFAST BAC1
- Backbone size w/o insert (bp) 4775
- Total vector size (bp) 8100
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSMARCC1
-
Alt nameBAF155
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3390
-
GenBank IDNM_003074.4
-
Entrez GeneSMARCC1 (a.k.a. BAF155, CRACC1, Rsc8, SRG3, SWI3)
- Promoter polyhedrin
-
Tags
/ Fusion Proteins
- His tag at C-terminus with GGGGS linker (C terminal on insert)
- His (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer pFAST-BAC seq-Fw: aaatgataaccatctcgc
- 3′ sequencing primer pFAST-BAC seq-Rv: tgtttcaggttcagggggag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypBS hBAF155 (Plasmid#17876) from addgene as template
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFAST-BAC BAF155/SMARCC1-His was a gift from Yoshihiro Izumiya (Addgene plasmid # 177863 ; http://n2t.net/addgene:177863 ; RRID:Addgene_177863) -
For your References section:
KSHV transactivator-derived small peptide traps coactivators to attenuate MYC and inhibits leukemia and lymphoma cell growth. Shimoda M, Lyu Y, Wang KH, Kumar A, Miura H, Meckler JF, Davis RR, Chantarasrivong C, Izumiya C, Tepper CG, Nakajima KI, Tuscano J, Barisone G, Izumiya Y. Commun Biol. 2021 Dec 2;4(1):1330. doi: 10.1038/s42003-021-02853-0. 10.1038/s42003-021-02853-0 PubMed 34857874