Skip to main content

pT7C-HSP90AB1
(Plasmid #177659)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177659 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pT7C
  • Backbone size w/o insert (bp) 3352
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    To produce protein, express in BL21(DE3) Codon Plus RIL. Purify by Ni IMAC and SEC.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HSP90AB1
  • Alt name
    NP_031381.2
  • Alt name
    HSP90AB1 Isoform A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2175
  • Entrez Gene
    HSP90AB1 (a.k.a. D6S182, HSP84, HSP90B, HSPC2, HSPCB)
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-Thrombin (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GATTATCAACCGGGGTGGCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Genes were cloned from a cDNA library and may contain silent mutations. However, all inserts were sequence-verified and any nucleotide changes were mutagenized to encode the consensus amino acid sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7C-HSP90AB1 was a gift from Jeff Kuret (Addgene plasmid # 177659 ; http://n2t.net/addgene:177659 ; RRID:Addgene_177659)
  • For your References section:

    Identification of gene networks mediating regional resistance to tauopathy in late-onset Alzheimer's disease. Ayoub CA, Wagner CS, Kuret J. PLoS Genet. 2023 Mar 27;19(3):e1010681. doi: 10.1371/journal.pgen.1010681. eCollection 2023 Mar. 10.1371/journal.pgen.1010681 PubMed 36972319