Venus-BclXL-pEGFP-C1
(Plasmid #177409)

• Purpose: To express Venus fused to the N-terminus of the Bcl-2 family protein, Bcl-XL.
• Depositing Lab: David Andrews
• Publication: Aranovich et al Mol Cell. 2012 Mar 30;45(6):754-63. doi: 10.1016/j.molcel.2012.01.030.

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bcl-XL
• Alt name: VBclXL, VBcl-XL, Venus-Bcl-XL, Bcl2 like protein 1 (Bcl2l1)
• Species: H. sapiens (human)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-BclXL-pEGFP-C1.gbk
• A portion of this plasmid was derived from a plasmid made by: BclXL sequence aligns with NCBI Reference Sequence: NM_001317919.2 of H. sapiens BCL2 like 1 (BCL2L1), transcript variant 3, mRNA. Venus sequence received from Dr. Ray Truant (McMaster University).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express Venus-fused to the N-terminus of Bcl-XL. There is a flexible, 7 aa linker "SGLRSTR", between Venus and BclXL. This Venus protein contains an F224R mutation to make it monomeric.