mouse Clock delta 19
(Plasmid #177312)

• Purpose: expression of mutant mouse clock
• Depositing Lab: Joseph Takahashi
• Publication: King et al Cell. 1997 May 16;89(4):641-53. doi: 10.1016/s0092-8674(00)80245-7.

Backbone

• Vector backbone: pcDNA
• Backbone manufacturer: invitrogen
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 2412
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mouse clock delta 19
• Species: M. musculus (mouse)
• Insert Size (bp): 2412
• Mutation: deletion from original mClock gene (514-564aa)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: pcDNA reverse primer

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry