Skip to main content
Addgene

PiggyBac-TetO-Lmx1a-t2a-Pitx3-puro
(Plasmid #176484)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176484 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Piggybac TetO - puromycin
  • Backbone size w/o insert (bp) 6585
  • Total vector size (bp) 9009
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    The Wernig lab uses Stbl3 or JM109 for downstream applications.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Lmx1A-T2A-Pitx3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2150
  • Entrez Gene
    PITX3 (a.k.a. ASGD1, ASMD, ASOD, CTPP4, CTRCT11, PTX3)
  • Entrez Gene
    LMX1A (a.k.a. DFNA7, LMX1, LMX1.1)
  • Promoter TetO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site PacI (unknown if destroyed)
  • 5′ sequencing primer TGACCTCCATAGAAGACACC
  • 3′ sequencing primer ggaggggcaaacaacagatg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PiggyBac-TetO-Lmx1a-t2a-Pitx3-puro was a gift from Marius Wernig (Addgene plasmid # 176484 ; http://n2t.net/addgene:176484 ; RRID:Addgene_176484)
  • For your References section:

    Efficient generation of dopaminergic induced neuronal cells with midbrain characteristics. Ng YH, Chanda S, Janas JA, Yang N, Kokubu Y, Sudhof TC, Wernig M. Stem Cell Reports. 2021 Jul 13;16(7):1763-1776. doi: 10.1016/j.stemcr.2021.05.017. Epub 2021 Jun 24. 10.1016/j.stemcr.2021.05.017 PubMed 34171286