pAAV-hAdipoq-GFP
(Plasmid
#176215)
-
PurposeExpresses GFP under the control of distal enhancer and the promoter of human adiponectin gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176215 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-CBA-w
- Backbone size w/o insert (bp) 5050
- Total vector size (bp) 5773
-
Modifications to backboneThe CBA promoter in the pAAV-CBA-W backbone was replaced with the human Adiponectin enhancer and promoter sequences.
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
Insert Size (bp)723
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AACTACTCGAGaccatggtgagcaagggcga
- 3′ sequencing primer TATTCAGCGGCCGCTTACTTGTACAGCTCGTCCATGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe Gfp cDNA was derived from pLenti-GFP-Blast (Addgene, plasmid #17445).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hAdipoq-GFP was a gift from Yu-Hua Tseng (Addgene plasmid # 176215 ; http://n2t.net/addgene:176215 ; RRID:Addgene_176215) -
For your References section:
FGF6 and FGF9 regulate UCP1 expression independent of brown adipogenesis. Shamsi F, Xue R, Huang TL, Lundh M, Liu Y, Leiria LO, Lynes MD, Kempf E, Wang CH, Sugimoto S, Nigro P, Landgraf K, Schulz T, Li Y, Emanuelli B, Kothakota S, Williams LT, Jessen N, Pedersen SB, Bottcher Y, Bluher M, Korner A, Goodyear LJ, Mohammadi M, Kahn CR, Tseng YH. Nat Commun. 2020 Mar 17;11(1):1421. doi: 10.1038/s41467-020-15055-9. 10.1038/s41467-020-15055-9 PubMed 32184391