Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-hAdipoq-GFP
(Plasmid #176215)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176215 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-CBA-w
  • Backbone size w/o insert (bp) 5050
  • Total vector size (bp) 5773
  • Modifications to backbone
    The CBA promoter in the pAAV-CBA-W backbone was replaced with the human Adiponectin enhancer and promoter sequences.
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Insert Size (bp)
    723

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AACTACTCGAGaccatggtgagcaagggcga
  • 3′ sequencing primer TATTCAGCGGCCGCTTACTTGTACAGCTCGTCCATGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The Gfp cDNA was derived from pLenti-GFP-Blast (Addgene, plasmid #17445).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hAdipoq-GFP was a gift from Yu-Hua Tseng (Addgene plasmid # 176215 ; http://n2t.net/addgene:176215 ; RRID:Addgene_176215)
  • For your References section:

    FGF6 and FGF9 regulate UCP1 expression independent of brown adipogenesis. Shamsi F, Xue R, Huang TL, Lundh M, Liu Y, Leiria LO, Lynes MD, Kempf E, Wang CH, Sugimoto S, Nigro P, Landgraf K, Schulz T, Li Y, Emanuelli B, Kothakota S, Williams LT, Jessen N, Pedersen SB, Bottcher Y, Bluher M, Korner A, Goodyear LJ, Mohammadi M, Kahn CR, Tseng YH. Nat Commun. 2020 Mar 17;11(1):1421. doi: 10.1038/s41467-020-15055-9. 10.1038/s41467-020-15055-9 PubMed 32184391