pSIN-Ldha
(Plasmid
#175939)
-
Purposeknockout mouse Ldha
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175939 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSIN
- Backbone size w/o insert (bp) 7099
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLdha gRNA
-
gRNA/shRNA sequenceGCTGGTCATTATCACCGCGG
-
SpeciesM. musculus (mouse)
-
Entrez GeneLdha (a.k.a. Ldh1, Ldhm, l7R2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BBS I (destroyed during cloning)
- 3′ cloning site BBS I (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
- 3′ sequencing primer AAAAAAGCACCGACTCGGTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSIN-Ldha was a gift from Dan Littman (Addgene plasmid # 175939 ; http://n2t.net/addgene:175939 ; RRID:Addgene_175939) -
For your References section:
Niche-Selective Inhibition of Pathogenic Th17 Cells by Targeting Metabolic Redundancy. Wu L, Hollinshead KER, Hao Y, Au C, Kroehling L, Ng C, Lin WY, Li D, Silva HM, Shin J, Lafaille JJ, Possemato R, Pacold ME, Papagiannakopoulos T, Kimmelman AC, Satija R, Littman DR. Cell. 2020 Aug 6;182(3):641-654.e20. doi: 10.1016/j.cell.2020.06.014. Epub 2020 Jul 1. 10.1016/j.cell.2020.06.014 PubMed 32615085