Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSIN-Ldha
(Plasmid #175939)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175939 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSIN
  • Backbone size w/o insert (bp) 7099
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ldha gRNA
  • gRNA/shRNA sequence
    GCTGGTCATTATCACCGCGG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ldha (a.k.a. Ldh1, Ldhm, l7R2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BBS I (destroyed during cloning)
  • 3′ cloning site BBS I (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • 3′ sequencing primer AAAAAAGCACCGACTCGGTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIN-Ldha was a gift from Dan Littman (Addgene plasmid # 175939 ; http://n2t.net/addgene:175939 ; RRID:Addgene_175939)
  • For your References section:

    Niche-Selective Inhibition of Pathogenic Th17 Cells by Targeting Metabolic Redundancy. Wu L, Hollinshead KER, Hao Y, Au C, Kroehling L, Ng C, Lin WY, Li D, Silva HM, Shin J, Lafaille JJ, Possemato R, Pacold ME, Papagiannakopoulos T, Kimmelman AC, Satija R, Littman DR. Cell. 2020 Aug 6;182(3):641-654.e20. doi: 10.1016/j.cell.2020.06.014. Epub 2020 Jul 1. 10.1016/j.cell.2020.06.014 PubMed 32615085