Skip to main content
Addgene

pAd5-B6/7deltaE3
(Plasmid #175748)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175748 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJet1.2
  • Backbone manufacturer
    ThermoFisher Scientific
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 10943
  • Vector type
    Adenoviral, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Adenovirus 5 genomic region 25043-35938
  • Species
    Adenovirus 5
  • Mutation
    Adenovirus sequences 27859-30803 replaced with BamHI-SalI cloning site, resulting in deletion of E3
  • GenBank ID
    AC_000008.1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
  • 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAd5-B6/7deltaE3 was a gift from Fred Bunz (Addgene plasmid # 175748 ; http://n2t.net/addgene:175748 ; RRID:Addgene_175748)
  • For your References section:

    AdenoBuilder: A platform for the modular assembly of recombinant adenoviruses. Jang Y, Bunz F. STAR Protoc. 2022 Jan 20;3(1):101123. doi: 10.1016/j.xpro.2022.101123. eCollection 2022 Mar 18. 10.1016/j.xpro.2022.101123 PubMed 35098167