-
PurposeBlock 1 for AdenoBuilder genome assembly
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJet1.2
-
Backbone manufacturerThermoFisher Scientific
- Backbone size w/o insert (bp) 2988
- Total vector size (bp) 6747
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAdenovirus 5 genomic region 1-3759
-
SpeciesAdenovirus 5
-
Insert Size (bp)3759
-
GenBank ID
- Promoter None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
- 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAd5-B1 was a gift from Fred Bunz (Addgene plasmid # 122551 ; http://n2t.net/addgene:122551 ; RRID:Addgene_122551) -
For your References section:
Seamless assembly of recombinant adenoviral genomes from high-copy plasmids. Miciak JJ, Hirshberg J, Bunz F. PLoS One. 2018 Jun 27;13(6):e0199563. doi: 10.1371/journal.pone.0199563. eCollection 2018. 10.1371/journal.pone.0199563 PubMed 29949649