pCI-neo VPS51-13Myc
(Plasmid
#175094)
-
Purpose13Myc tagged VPS51 is expressed in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCI-neo
- Backbone size w/o insert (bp) 5456
- Total vector size (bp) 8354
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVPS51
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2346
- Promoter CMV
-
Tag
/ Fusion Protein
- 13Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer CCACTCCCAGTTCAATTACAGCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-neo VPS51-13Myc was a gift from Juan Bonifacino (Addgene plasmid # 175094 ; http://n2t.net/addgene:175094 ; RRID:Addgene_175094) -
For your References section:
A neurodevelopmental disorder caused by mutations in the VPS51 subunit of the GARP and EARP complexes. Gershlick DC, Ishida M, Jones JR, Bellomo A, Bonifacino JS, Everman DB. Hum Mol Genet. 2019 May 1;28(9):1548-1560. doi: 10.1093/hmg/ddy423. 10.1093/hmg/ddy423 PubMed 30624672