pCI-neo VPS50-13Myc
(Plasmid
#175093)
-
Purpose13Myc tagged VPS50 is expressed in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCI-neo
- Backbone size w/o insert (bp) 5456
- Total vector size (bp) 8900
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVPS50
-
Alt namesyndetin
-
Alt nameCCDC132
-
Alt nameVPS54L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2892
-
Entrez GeneCCDC132 (a.k.a. FLJ20097, FLJ23581, KIAA1861, MGC176659)
- Promoter CMV
-
Tag
/ Fusion Protein
- 13Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer CCACTCCCAGTTCAATTACAGCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-neo VPS50-13Myc was a gift from Juan Bonifacino (Addgene plasmid # 175093 ; http://n2t.net/addgene:175093 ; RRID:Addgene_175093) -
For your References section:
EARP is a multisubunit tethering complex involved in endocytic recycling. Schindler C, Chen Y, Pu J, Guo X, Bonifacino JS. Nat Cell Biol. 2015 May;17(5):639-50. doi: 10.1038/ncb3129. Epub 2015 Mar 23. 10.1038/ncb3129 PubMed 25799061