Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCI-neo VPS50-13Myc
(Plasmid #175093)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175093 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCI-neo
  • Backbone size w/o insert (bp) 5456
  • Total vector size (bp) 8900
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VPS50
  • Alt name
    syndetin
  • Alt name
    CCDC132
  • Alt name
    VPS54L
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2892
  • Promoter CMV
  • Tag / Fusion Protein
    • 13Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer CCACTCCCAGTTCAATTACAGCTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-neo VPS50-13Myc was a gift from Juan Bonifacino (Addgene plasmid # 175093 ; http://n2t.net/addgene:175093 ; RRID:Addgene_175093)
  • For your References section:

    EARP is a multisubunit tethering complex involved in endocytic recycling. Schindler C, Chen Y, Pu J, Guo X, Bonifacino JS. Nat Cell Biol. 2015 May;17(5):639-50. doi: 10.1038/ncb3129. Epub 2015 Mar 23. 10.1038/ncb3129 PubMed 25799061