Skip to main content
Addgene

lentiCRISPRv2_sgCtrl#2
(Plasmid #174149)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174149 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Control sgRNA
  • gRNA/shRNA sequence
    GATCCTTATTGCTCCATTCT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmbI (destroyed during cloning)
  • 3′ cloning site BsmbI (destroyed during cloning)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPRv2_sgCtrl#2 was a gift from Julien Sage (Addgene plasmid # 174149 ; http://n2t.net/addgene:174149 ; RRID:Addgene_174149)
  • For your References section:

    The AMBRA1 E3 ligase adaptor regulates the stability of cyclin D. Chaikovsky AC, Li C, Jeng EE, Loebell S, Lee MC, Murray CW, Cheng R, Demeter J, Swaney DL, Chen SH, Newton BW, Johnson JR, Drainas AP, Shue YT, Seoane JA, Srinivasan P, He A, Yoshida A, Hipkins SQ, McCrea E, Poltorack CD, Krogan NJ, Diehl JA, Kong C, Jackson PK, Curtis C, Petrov DA, Bassik MC, Winslow MM, Sage J. Nature. 2021 Apr;592(7856):794-798. doi: 10.1038/s41586-021-03474-7. Epub 2021 Apr 14. 10.1038/s41586-021-03474-7 PubMed 33854239